Journal: Cell reports

Article Title: A Microglia Sublineage Protects from Sex-Linked Anxiety Symptoms and Obsessive Compulsion

doi: 10.1016/j.celrep.2019.09.045

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-RFP Rockland Cat#600-401-379; RRID:AB_2209751 anti-lba1 Wako Cat#019–19741; RRID:AB_839504 Alexa Fluor 555 Invitrogen Cat#A31572; RRID:AB_162543 anti CD11b-APC BioLegend Cat#101212; RRID: AB_312795 anti CD45-FITC BioLegend Cat#103108; RRID: AB_312973 Chemicals, Peptides, and Recombinant Proteins Urocortin II Millipore-Sigma Cat# U9507 Trilostane Millipore-Sigma Cat#SML0141 Estrogen Millipore-Sigma Cat#PHR1353 Progesterone Millipore-Sigma Cat#P3972 Critical Commercial Assays Cortisol ELISA Kit Arbor Assays Cat#K003 Estradiol ELISA Kit Arbor Assays Cat#K030 Progesterone ELISA Kit Arbor Assays Cat#K025 Creatinine Urinary Detection Kit Arbor Assays Cat#K002 Deposited Data raw and analyzed data This paper N/A Experimental Models: Organisms/Strains Hoxb8 ko Mario Capecchi RRID 4818890 Hoxb8 IRES-Cre Mario Capecchi RRID 4837097 Hoxb8 mut-IRES-Cre This paper N/A Csf1r flox The Jackson Laboratory Stock# 021212; RRID 3653677 Rosa26 lsl-tdTomato The Jackson Laboratory Stock# 007914; RRID 4436847 Oligonucleotides Hoxb8 mut-IRES-Cre genotyping primer: gccagacctacagtcgctacca (forward) This paper N/A Hoxb8 mut-IRES-Cre genotyping primer: cttcttgtcacccttctgcgcatcg (reverse) This paper N/A Software and Algorithms MATLAB and Image Acquisition/Image Processing Toolboxes Release 2015a The MathWorks, Inc. https://www.mathworks.com/products/get-matlab.html?s_tid=gn_getml Leica Application Suite X Leica Microsystems https://www.leica-microsystems.com/products/microscope-software/p/leica-las-x-ls/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FlowJo FlowJo, LLC https://www.flowjo.com/solutions/flowjo/downloads GraphPad Prism version 8.0.0 GraphPad Software https://www.graphpad.com Open in a separate window KEY RESOURCES TABLE A microglia sublineage derived from Hoxb8-expressing precursors serves unique functions Dysfunction of Hoxb8-lineage microglia causes anxiety symptoms and obsessive compulsion Female sex hormones worsen the pathology caused by Hoxb8-lineage microglia dysfunction

Techniques: Recombinant, Enzyme-linked Immunosorbent Assay, Software

Journal: Neuron

Article Title: Neural mechanisms of sustained attention are rhythmic

doi: 10.1016/j.neuron.2018.07.032

Figure Lengend Snippet: KEY RESOURCE TABLE

Article Snippet: Subsequently, we combined z-scores across observers and then turned the averaged z-scores into a probability using the cumulative distribution function φ according to the following formula: p combined = 1 − φ ( ∑ i = 1 : N φ − 1 1 − p i N ) table ft1 table-wrap mode="anchored" t5 REAGENT or RESOURCE SOURCE IDENTIFIER Software and Algorithms Presentation Neurobehavioral Systems Inc. https://www.neurobs.com EPrime Psychology Software Tools Inc. https://pstnet.com/ MATLAB 2015a MathWorks Inc. RRID: SCR_001622 EEGLAB 13_4_4b ( Delorme and Makeig, 2004 ) https://sccn.ucsd.edu/eeglab/index.php FieldTrip 20170912 ( Oostenveld et al., 2011 ) http://www.fieldtriptoolbox.org/ CircStat 2012 ( Berens, 2009 ) https://philippberens.wordpress.com/code/circstats/ IRASA ( Wen and Liu, 2016 ) https://purr.purdue.edu/publications/1987/1 SPM8 ( Penny et al., 2011 ) http://www.fil.ion.ucl.ac.uk/spm/ Freesurfer 5.3.0 ( Dale et al., 1999 ) https://surfer.nmr.mgh.harvard.edu/ ibootci Andrew Penn; MATLAB central https://mathworks.com/matlabcentral/fileexchange/52741-ibootci Open in a separate window KEY RESOURCE TABLE We furthermore used Pearson’s correlation coefficient to delineate functional networks ( / ).

Techniques: Software